|  Help  |  About  |  Contact Us

Allele : Atosb<em1(IMPC)J> atos homolog B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7463966 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Atosb
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCAGCCTAAGATCTCAT and GCAGAGCTTGTCCCAAAGCG, which resulted in a 4988 bp deletion beginning at Chromosome 4 position 43,032,325 bp and ending after 43,037,312 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362071, ENSMUSE00000342963, ENSMUSE00000390285, ENSMUSE00001303795, ENSMUSE00001252670, ENSMUSE00001212016, ENSMUSE00001285070, ENSMUSE00001213061 (exons 2-9) and 2031 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories