| Primary Identifier | MGI:7463966 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atosb |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCAGCCTAAGATCTCAT and GCAGAGCTTGTCCCAAAGCG, which resulted in a 4988 bp deletion beginning at Chromosome 4 position 43,032,325 bp and ending after 43,037,312 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362071, ENSMUSE00000342963, ENSMUSE00000390285, ENSMUSE00001303795, ENSMUSE00001252670, ENSMUSE00001212016, ENSMUSE00001285070, ENSMUSE00001213061 (exons 2-9) and 2031 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to result in a null allele. |
