|  Help  |  About  |  Contact Us

Allele : Krt17<em1Cou> keratin 17; endonuclease-mediated mutation 1, Pierre A Coulombe

Primary Identifier  MGI:7464110 Allele Type  Endonuclease-mediated
Attribute String  Hypomorph Gene  Krt17
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The nuclear localization signal sequence was targeted with an sgRNA (targeting GTACAAGCCAAAAGAACGTAAGG) and an ssODN template (GCATTAGGGGTGAGGAAGGTACTCTCGGATTTCATCTAATCTCTCCAACTTTTTTTTTCCAGCCTGACTCAGTACGCGCCAGCAGAACGTAAGGATATTGGTAACTGAGGGCTGGGGTAGAAGGATGCATGTGGCAGGAATCGCCTAGCAGATTGCTAGG) using CRISPR/Cas9 technology, resulting in lysine codon 399 (AAG) to alanine (GCG) (K399A) and lysine codon 401 (AAA) to alanine (GCA) (K401A) mutations. These mutations destroy the NLS.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Krt17<deltaNLS>,
  • Krt17<deltaNLS>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories