| Primary Identifier | MGI:7470779 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kif18a |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 67 (AGG) was changed to lysine (AAA) (p.R67K) using an sgRNA (targeting CAAATTTTGATATTACTAAA) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the mouse residue to the residue found in the orthologous human gene. |
