| Primary Identifier | MGI:7464723 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Defa30 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide RNA sequence 5' CATGGTCATCTTGTTCTCTG 3' and single stranded DNA oligo with sequence 5' AGAAGTGGTCATCAGGCACCAGCGTCAGTGGCCTCAGTACTCATGGTCATCTTGTTCTCTcTGGTCTCCATGTTCAgtggtgatggtgatgatgtccggagccGCGACAGCAGAGCATGTACATTAAATGACCCTTACTGCAGGTCCCATTCATGCGTTCTCT 3' in C57BL/6J zygotes which resulted in the addition of a C-terminal GSG-linker and His-tag to the coding sequence of the gene (ENSMUSG00000074444). The GSG-linker + His-tag was inserted directly before the stop codon of the gene at position (chr8:21625516). All base annotations are according to C57BL/6J genome assembly GRCm39. |
