|  Help  |  About  |  Contact Us

Allele : Defa30<em1Irc> defensin, alpha, 30; endonuclease-mediated mutation 1, Inflammation Research Center

Primary Identifier  MGI:7464723 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag Gene  Defa30
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide RNA sequence 5' CATGGTCATCTTGTTCTCTG 3' and single stranded DNA oligo with sequence 5' AGAAGTGGTCATCAGGCACCAGCGTCAGTGGCCTCAGTACTCATGGTCATCTTGTTCTCTcTGGTCTCCATGTTCAgtggtgatggtgatgatgtccggagccGCGACAGCAGAGCATGTACATTAAATGACCCTTACTGCAGGTCCCATTCATGCGTTCTCT 3' in C57BL/6J zygotes which resulted in the addition of a C-terminal GSG-linker and His-tag to the coding sequence of the gene (ENSMUSG00000074444). The GSG-linker + His-tag was inserted directly before the stop codon of the gene at position (chr8:21625516). All base annotations are according to C57BL/6J genome assembly GRCm39.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele