|  Help  |  About  |  Contact Us

Allele : Ncf1<em1Nansh> neutrophil cytosolic factor 1; endonuclease-mediated mutation 1, Nan Shen

Primary Identifier  MGI:7464912 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ncf1
Is Recombinase  false Is Wild Type  false
molecularNote  Arginine codon 90 (CGC) in exon 4 was changed to histidine (CAC) (p.R90H) using an sgRNA (targeting ACGAGCCGCTGAGAGTCGCC) and an ssODN template (CATGGGTCTCTGGCTCCCCCACCCAGCACCCAGGTGGTTTGATGGGCAACGAGCAGCTGAGTCCCACCAGGGCACTCTCACTGAATACTTCAACGGCCTCATGGGACTGCCCGTGAAGAT) with CRISPR/Cas9 technology. The mutation (SNP rs201802880) is found in some systemic lupus erythematosus (SLE) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • NCF1 p.R90H,
  • NCF1 p.R90H
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories