| Primary Identifier | MGI:7470780 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Knl1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Histidine codon 109 (CAT) was changed to arginine (CGC) (p.H109R) and glycine codon 910 (GGC) to serine (TCC) (p.G910S) using sgRNAs (targeting CATTTGCATGTTTCCTTTCA and TTTCTGAATGAACTTCTGTC) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (R159, S1086). |
