|  Help  |  About  |  Contact Us

Allele : Knl1<em1Svap> kinetochore scaffold 1; endonuclease-mediated mutation 1, Svante Paabo

Primary Identifier  MGI:7470780 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Knl1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  Histidine codon 109 (CAT) was changed to arginine (CGC) (p.H109R) and glycine codon 910 (GGC) to serine (TCC) (p.G910S) using sgRNAs (targeting CATTTGCATGTTTCCTTTCA and TTTCTGAATGAACTTCTGTC) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (R159, S1086).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • hKNL1,
  • hKNL1
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele