|  Help  |  About  |  Contact Us

Allele : Nes<em2Pqt> nestin; endonuclease-mediated mutation 2, Paul Q Thomas

Primary Identifier  MGI:7447465 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nes
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exons 1 and 4 were targeted with two sgRNAs (targeting GGAGCTCAATCGACGCCTGG and GCACAGGAGACCCTACTAAA) using CRISPR/Cas9 technology, resulting in an 8705 bp deletion (chr3:87878559-87887263 (GRCm39)).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Nes BD,
  • Nes BD
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories