| Primary Identifier | MGI:7464782 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rhobtb2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCAATTCCGAATAATAAG and CTCCACGCTGAGCGGAAGCA, which resulted in a 3821 bp deletion beginning at Chromosome 14 position 69,796,110 bp and ending after 69,799,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000556573, ENSMUSE00000123406, ENSMUSE00000263693 (exons 3,4, and 5) and 2512 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 1 amino acid later. |
