| Primary Identifier | MGI:7464807 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Phyhd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACTACAGATGCCTCCTGG and GCTTGCTTTTCTGCACTCCC, which resulted in a 592 bp deletion beginning at Chromosome 2 position 30,274,151 bp and ending after 30,274,742 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000662834 and ENSMUSE00000604424 (exons 4 and 5) and 468 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 61 amino acids later. There is a 7 bp insertion (AGGGGGC)at the deletion site. The deletion also removes non-coding exon 6 ENSMUSE00000734429 from Gm28035. |
