|  Help  |  About  |  Contact Us

Allele : Rr253<em5Kmm> regulatory region 253; endonuclease-mediated mutation 5, Kenneth M Murphy

Primary Identifier  MGI:7448466 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr253
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using zygotes that already carry the Rr253em3Kmm NFIL3–C/EBP binding site 1-deletion allele, binding sites 2 and 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with sgRNAs (targeting ATTTTGCAACCCCCCAAAAA and CCGGTGACACACACTGCTCA) and an ssODN template (TGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGAGTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTTCCTGATTGCACACACCTGTTTGGGGCATGGAGTCGACCTCCCCCCAAAAAGGGGAAACTGAACTCACTGCTCCTCCTGAG) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1 and 3.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • delta1+3,
  • delta1+3
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories