|  Help  |  About  |  Contact Us

Allele : Rr253<em6Kmm> regulatory region 253; endonuclease-mediated mutation 6, Kenneth M Murphy

Primary Identifier  MGI:7448467 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr253
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using zygotes that already carry the Rr253em4Kmm NFIL3–C/EBP binding site 1&2-deletion allele, binding site 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with an sgRNA (targeting CCACCAGCCGGTGACACACA) and an ssODN template (GCTGAAGTTCACCTCCCCATGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGACTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTT) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1, 2 and 3.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • delta1+2+3,
  • delta1+2+3
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories