| Primary Identifier | MGI:7448757 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr364729 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Gal enhancer was targeted with sgRNAs (targeting CTCCCTGGAGCAATATGAAG and CCCGCTTTCATGGCTCCCAA) using CRISPR/Cas9 technology, resulting in a 257 bp deletion (chr19:3490919-3491175 (GRCm39)). The orthologous human enhancer is implied in male anxiety and ethanol intake. |