|  Help  |  About  |  Contact Us

Allele : Rr364729<em1Almk> regulatory region 364729; endonuclease-mediated mutation 1, Alasdair MacKenzie

Primary Identifier  MGI:7448757 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr364729
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Gal enhancer was targeted with sgRNAs (targeting CTCCCTGGAGCAATATGAAG and CCCGCTTTCATGGCTCCCAA) using CRISPR/Cas9 technology, resulting in a 257 bp deletion (chr19:3490919-3491175 (GRCm39)). The orthologous human enhancer is implied in male anxiety and ethanol intake.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • mGAL5.1KO,
  • mGAL5.1KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories