|  Help  |  About  |  Contact Us

Allele : Adam22<em3Mafu> a disintegrin and metallopeptidase domain 22; endonuclease-mediated mutation 3, Masaki Fukata

Primary Identifier  MGI:7466594 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Adam22
Strain of Origin  (C57BL/6 X DBA/2)F1 x C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Serine codon 832 (TCC) in exon 28 was changed to alanine (GCC) (p.S832A) using an sgRNA (targeting CCTTGCCAGGAGTTACTGCG) and ssODN template with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue.
  • mutations:
  • Single point mutation
  • synonyms:
  • Adam22<SA>,
  • Adam22<S832A>,
  • Adam22<S832A>,
  • Adam22<SA>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories