|  Help  |  About  |  Contact Us

Allele : Ctnna1<em1Xjz> catenin alpha 1; endonuclease-mediated mutation 1, Xianjun Zhu

Primary Identifier  MGI:7466923 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ctnna1
Inheritance Mode  Dominant Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Phenylalanine codon 72 (TTC) in exon 3 was changed to serine (TCC) (p.F72S) using an sgRNA (targeting AAGCAACTGAGAATTTCTTGG) and an ssODN template (CCATGTTTTGGCTGCATCTGTTGAACAAGCAACTGAGAATTCCTTGGAAAAGGGGGATAAAATTGCAAAAGAGAGCCAGT) with CRIPSR/Cas9 technology. The equivalent human mutation is found in some familial exudative vitreoretinopathy (FEVR) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • Ctnna1<F72S>,
  • Ctnna1<F72S>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele