|  Help  |  About  |  Contact Us

Allele : Dpy19l4<em1(IMPC)J> dpy-19 like 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7466927 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dpy19l4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACAGCAAGCGCTTAGAC and AAGAATACCCTACAAACAGC, which resulted in a 1497 bp deletion beginning at Chromosome 4 position 11,303,116 bp and ending after 11,304,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291800, ENSMUSE00001305659, ENSMUSE00000385379 (exons 4, 5, 6) and 1138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 84 amino acids later. 61 bp before the deletion site there is an indel with 2 bp insertion (AA) and 5 bp deletion (CTGCT).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories