|  Help  |  About  |  Contact Us

Allele : Lrp5<em1Xjz> low density lipoprotein receptor-related protein 5; endonuclease-mediated mutation 1, Xianjun Zhu

Primary Identifier  MGI:7466960 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Lrp5
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 847 (CCG) in exon 12 was changed to leucine (CTG) (p.P847L) using an sgRNA (targeting GACGATCTGCCCTACCCGTTTGG) and an ssODN template (TATGTGCTATGTCCCCGCACAGGTCAGGAGCGCATGGTGATAGCTGACGATCTGCCCTACCTGTTTGGCCTGACTCAATATAGCGATTACATCTACTGGACTGACTGGAACCTGCATAGCATT) with CRIPSR/Cas9 technology. The equivalent human mutation (p.P848L) is found in some familial exudative vitreoretinopathy (FEVR) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • Lrp5<P847L>,
  • Lrp5<P847L>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories