|  Help  |  About  |  Contact Us

Allele : Cfap100<em1(IMPC)J> cilia and flagella associated protein 100; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7450836 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cfap100
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGGCAGGAACACAGGGG and CTAAAATCAAGATCCAGCAG, which resulted in a 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260855 and ENSMUSE00000452276 (exons 10 and 11) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 308 and early truncation 28 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories