|  Help  |  About  |  Contact Us

Allele : Tssk3<em3Amsa> testis-specific serine kinase 3; endonuclease-mediated mutation 3, Ana M Salicioni

Primary Identifier  MGI:7451038 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tssk3
Strain of Origin  (C57BL/6J x DBA/2J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology generated a 47 bp deletion (TCCAATGGGTATCAGCTGGGCAAGACCATTGGGGAAGGGACCTACTC) in exon 1 resulting in a frameshift mutation and an early stop codon. Absence of the targeted region was confirmed by PCR and Sanger sequencing.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tssk3<-> Line 3,
  • Tssk3<-> Line 3
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories