| Primary Identifier | MGI:7451038 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tssk3 |
| Strain of Origin | (C57BL/6J x DBA/2J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology generated a 47 bp deletion (TCCAATGGGTATCAGCTGGGCAAGACCATTGGGGAAGGGACCTACTC) in exon 1 resulting in a frameshift mutation and an early stop codon. Absence of the targeted region was confirmed by PCR and Sanger sequencing. |
