|  Help  |  About  |  Contact Us

Allele : Ankrd34a<em1(IMPC)J> ankyrin repeat domain 34A; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7468702 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ankrd34a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGAAGAAGAGCGTGGCCCT and CTTCAGCGCCCGGGTTCCCC, which resulted in a 1457 bp deletion beginning at Chromosome 3 position 96,597,496 bp and ending after 96,598,952 bp (GRCm38/mm10). This mutation deletes 1457 bp from ENSMUSE00000410687 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 24 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories