| Primary Identifier | MGI:7468702 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd34a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGAAGAAGAGCGTGGCCCT and CTTCAGCGCCCGGGTTCCCC, which resulted in a 1457 bp deletion beginning at Chromosome 3 position 96,597,496 bp and ending after 96,598,952 bp (GRCm38/mm10). This mutation deletes 1457 bp from ENSMUSE00000410687 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 24 amino acids later. |
