|  Help  |  About  |  Contact Us

Allele : Armc10<em1(IMPC)J> armadillo repeat containing 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7461753 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Armc10
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCGCCTCCCCTCCCAC and GGATAGCTAAGAGTTCAGAA, which resulted in a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602887 (exon 2) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 4 amino acids later. There is a 7 bp (CCCCCCC) insertion at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories