| Primary Identifier | MGI:7461809 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tsr1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACAGGTGCTGTAACCCCA and CTGCTGGTGTGGGCTATACT, which resulted in a 651 bp deletion beginning at Chromosome 11 position 74,899,096 bp and ending after 74,899,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258182 and ENSMUSE00001246763 (exons 3 and 4) and 296 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 1 amino acid later. There is a 7 bp insertion (TATACTT) 16 bp before the deletion site. |