| Primary Identifier | MGI:7461814 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eif4a2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCGTTTTCAGCAGAGCACAG and ATCCACCCTGAGAAACCTAT, which resulted in a 995 bp deletion beginning at Chromosome 16 position 23,108,486 bp and ending after 23,109,480 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306288, ENSMUSE00001235294 and ENSMUSE00000560683 (exons 2, 3 and 4) and 676 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 3 amino acids later. |
