|  Help  |  About  |  Contact Us

Allele : Phldb3<em1(IMPC)J> pleckstrin homology like domain, family B, member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7481968 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Phldb3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCTGATGACATCACTTGG and GCTCAGTTCTGGCTTCGGAT, which resulted in a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000890035, ENSMUSE00000890716, ENSMUSE00000499900, ENSMUSE00000891408, ENSMUSE00000479582 (exons 10-14) and 2714 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 384 and early truncation 34 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories