|  Help  |  About  |  Contact Us

Allele : Tenm1<em2Tcp> teneurin transmembrane protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:7482185 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tenm1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGTACAGATCTATGGGCAA and TCATGGTAGATGTCACCATA targeting within ENSMUSE00000327545. This resulted in an 841bp deletion of ChrX from 41624774 to 41625614 with the insertion of T (GRCm39), introducing a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories