| Primary Identifier | MGI:7486743 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp605 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATATATCATTAAGCAAAAC and TTAAGGCAGGACAGTCCATC, which resulted in a 18,020 bp deletion beginning at Chromosome 5 position 110,111,841 bp and ending after 110,129,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309111, ENSMUSE00001300810, ENSMUSE00001293032, ENSMUSE00000692012 (exons 2, 3 ,4 and 5) and 15,088 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
