| Primary Identifier | MGI:7481964 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Endod1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTACTTTAGACAATTCCG and TGACCCTGACAGCAACCTCG, which resulted in a 1172 bp deletion beginning at Chromosome 9 position 14,356,695 bp and ending after 14,357,866 bp (GRCm38/mm10). This mutation deletes 1172 bp from ENSMUSE00000361525 (exon 2) and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 21 amino acids later. |
