|  Help  |  About  |  Contact Us

Allele : Il2rg<em3Lutzy> interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 3, Cathy Lutz

Primary Identifier  MGI:7482336 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Il2rg
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Donor DNAs were originally designed to introduce loxP sequences flanking exon 3. Il2rg transcript Il2rg-201 was used as reference for the exon number and the guide sequences. DNA sequencing of the targeted region identified a 334 nt deletion (indel mutation)[CATTGTCAGTTCAGAC//CAGAAAAGAGAAGAT].
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Il2rg KO,
  • Il2rg KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

2 Publication categories