|  Help  |  About  |  Contact Us

Allele : Skic8<em1(IMPC)Tcp> SKI8 subunit of superkiller complex; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7482622 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Skic8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGGTGCGTTGAGATGATA targeting the 5' side and GCATAACTCCTCATCCTATG targeting the 3' side of a critical region (ENSMUSE00001147183). This resulted in a 147bp deletion of Chr9 from 54631312 to 54631458 (GRCm39), introducing a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories