| Primary Identifier | MGI:7511620 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Aicda |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Glutamine codon 133 (GGG) was changed to valine (GTA) (p.G133V) using an sgRNA (targeting CTGCGGAGACTGCACCGCGC) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation associated with HIGM2 (hyper-IgM syndrome type 2). |
