|  Help  |  About  |  Contact Us

Allele : Ptk2b<em2Yank> PTK2 protein tyrosine kinase 2 beta; endonuclease-mediated mutation 2, Yanping Kuang

Primary Identifier  MGI:7511568 Allele Type  Endonuclease-mediated
Gene  Ptk2b Is Recombinase  false
Is Wild Type  false
molecularNote  Tyrosine codon 402 (TAT) in exon 13 was changed to phenylalanine (TTT) (p.Y402F) using an sgRNA and an ssODN template (GGGCTGGGCCCCTTTCTGTCATTACAGAGTCAGACATCTTTGCAGAGATTCCCGATGAGACCCTGCGAAGACCAGGAGG) with CRISPR/Cas9 technology. This mutation prevents autophosphorylation of the residue in the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • PTK2B<Y402F>,
  • PTK2B<Y402F>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories