| Primary Identifier | MGI:7507082 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Ripk1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Lysine codon 612 (AAA) in exon 11 was changed to arginine (AGG) (p.K612R) using an sgRNA (targeting AATGCTTCAGAAGTGGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation prevents linear ubiquination of the residue in the encoded peptide. |
