| Primary Identifier | MGI:7510126 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Plaat1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGTTCCACATTATCAGA and GGACGTCTTGAAATCTGGGC, which resulted in a 3242 bp deletion beginning at Chromosome 16 position 29,217,529 bp and ending after 29,220,770 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294575 and ENSMUSE00000266795 (exons 2 and 3) and 2837 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. |
