|  Help  |  About  |  Contact Us

Allele : Plaat1<em1(IMPC)J> phospholipase A and acyltransferase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7510126 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Plaat1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGTTCCACATTATCAGA and GGACGTCTTGAAATCTGGGC, which resulted in a 3242 bp deletion beginning at Chromosome 16 position 29,217,529 bp and ending after 29,220,770 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294575 and ENSMUSE00000266795 (exons 2 and 3) and 2837 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele