| Primary Identifier | MGI:7511609 | Allele Type | Endonuclease-mediated |
| Gene | Rapsn | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 164 (CGT) in exon 2 was changed to histidine (CAC) (p.R164H) using an sgRNA (targeting TGCCCAGGCTGCAGCAGACA) and an ssODN template with CRISPR/Cas9 technology. This mutation in the fifth TRP motif inhibits Rapsn LLPS (liquid-liquid phase separation). |
