|  Help  |  About  |  Contact Us

Allele : Rapsn<em1Line> receptor-associated protein of the synapse; endonuclease-mediated mutation 1, Lin Mei

Primary Identifier  MGI:7511609 Allele Type  Endonuclease-mediated
Gene  Rapsn Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Arginine codon 164 (CGT) in exon 2 was changed to histidine (CAC) (p.R164H) using an sgRNA (targeting TGCCCAGGCTGCAGCAGACA) and an ssODN template with CRISPR/Cas9 technology. This mutation in the fifth TRP motif inhibits Rapsn LLPS (liquid-liquid phase separation).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Rapsn R164H,
  • Rapsn R164H
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories