| Primary Identifier | MGI:7506302 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | G6pc1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 83 (CGC) in exon 2 was changed to cysteine (TGC) (p.R83C) using an sgRNA (targeting GTTTGGACAACGCCCGTATTG) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation found in glycogen storage disease type Ia (GSD-Ia) patients. |
