|  Help  |  About  |  Contact Us

Allele : G6pc1<em1Jyc> glucose-6-phosphatase catalytic subunit 1; endonuclease-mediated mutation 1, Janice Yang Chou

Primary Identifier  MGI:7506302 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  G6pc1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 83 (CGC) in exon 2 was changed to cysteine (TGC) (p.R83C) using an sgRNA (targeting GTTTGGACAACGCCCGTATTG) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation found in glycogen storage disease type Ia (GSD-Ia) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • G6pc-R83C,
  • G6pc-R83C
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele