| Primary Identifier | MGI:7507065 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Cfi |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Aspartic acid codon 288 (GAC) in exon 6 was changed to glycine (GGC) (p.D288G) using sgRNAs (targeting ACCAATACAAGTGTAATGGTG and ACATATGTGTGATGTGCACG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.D283G mutation associated with C3 glomerulonephritis (C3GN). |