|  Help  |  About  |  Contact Us

Allele : Cfi<em1Jiwe> complement component factor i; endonuclease-mediated mutation 1, Jiqiu Wen

Primary Identifier  MGI:7507065 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Cfi
Is Recombinase  false Is Wild Type  false
molecularNote  Aspartic acid codon 288 (GAC) in exon 6 was changed to glycine (GGC) (p.D288G) using sgRNAs (targeting ACCAATACAAGTGTAATGGTG and ACATATGTGTGATGTGCACG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.D283G mutation associated with C3 glomerulonephritis (C3GN).
  • mutations:
  • Single point mutation
  • synonyms:
  • CFI-D288G,
  • CFI-D288G
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories