|  Help  |  About  |  Contact Us

Allele : Pik3cd<em1Stgt> phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta; endonuclease-mediated mutation 1, Stuart G Tangye

Primary Identifier  MGI:7539174 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Pik3cd
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamic acid codon 1020 (GAA) in exon 22 was changed to lysine (AAA) (p.E1020K) using an sgRNA (targeting GAGCTTCGTTGAACTTCACCCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.E1021K gain-of-function (GOF) mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) disease.
  • mutations:
  • Single point mutation
  • synonyms:
  • Pik3cd GOF,
  • Pik3cd<E1020K>,
  • Pik3cd<E1020K>,
  • Pik3cd GOF
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories