| Primary Identifier | MGI:7489686 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr426 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Tbx5 lung enhancer, located downstream of the gene, was targeted with sgRNAs (targeting ACTGGAAATCAAGACTGGGCAGG, GGAAACTGGAAATCAAGACTGGG, GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG) using CRISPR/Cas9 technology, resulting in an 843 bp deletion (chr5:120239700-120240542 (GRCm39)). |