|  Help  |  About  |  Contact Us

Allele : Rr426<em1Axvi> regulatory region 426; endonuclease-mediated mutation 1, Axel Visel

Primary Identifier  MGI:7489686 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr426
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The Tbx5 lung enhancer, located downstream of the gene, was targeted with sgRNAs (targeting ACTGGAAATCAAGACTGGGCAGG, GGAAACTGGAAATCAAGACTGGG, GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG) using CRISPR/Cas9 technology, resulting in an 843 bp deletion (chr5:120239700-120240542 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • enhancer delta,
  • enhancer delta
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories