|  Help  |  About  |  Contact Us

Allele : Sting1<em2Zjc> stimulator of interferon response cGAMP interactor 1; endonuclease-mediated mutation 2, Zhijian Chen

Primary Identifier  MGI:7490022 Allele Type  Endonuclease-mediated
Gene  Sting1 Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
molecularNote  A L373A (nucleotide change CTC to GCC) mutation is introduced to the TBK1 recruitment motif in exon 8 using CRISPR/cas9 methodologies (sgRNA AGATGAGGTCAGTGCGGAGT). A silent CTC to CTT mutation at amino acid 371 was introduced for genotyping purposes and to prevent Cas9/gRNA from targeting already edited sequences.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • STING-L373A,
  • STING-L373A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories