| Primary Identifier | MGI:7490022 | Allele Type | Endonuclease-mediated |
| Gene | Sting1 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A L373A (nucleotide change CTC to GCC) mutation is introduced to the TBK1 recruitment motif in exon 8 using CRISPR/cas9 methodologies (sgRNA AGATGAGGTCAGTGCGGAGT). A silent CTC to CTT mutation at amino acid 371 was introduced for genotyping purposes and to prevent Cas9/gRNA from targeting already edited sequences. |
