| Primary Identifier | MGI:7539398 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ikzf3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Asparagine codon 159 (AAC) in exon 5 was changed to serine (AGT) (p.N159S) using a crRNA (targeting GCAGTTTAATATGACGGAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.N160S dominant-negative mutation associated with combined immunodeficiency (CID). |