|  Help  |  About  |  Contact Us

Allele : Ikzf3<em4Itan> IKAROS family zinc finger 3; endonuclease-mediated mutation 4, Ichiro Taniuchi

Primary Identifier  MGI:7539398 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ikzf3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Asparagine codon 159 (AAC) in exon 5 was changed to serine (AGT) (p.N159S) using a crRNA (targeting GCAGTTTAATATGACGGAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.N160S dominant-negative mutation associated with combined immunodeficiency (CID).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Ikzf3<N159S>,
  • Ikzf3<N159S>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories