| Primary Identifier | MGI:7539173 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam110a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGTGGAACCAGAACCCAG and GGTCCCCGCCCACTACTGGA, which resulted in a 1930 bp deletion beginning at Chromosome 2 position 151,969,166 bp and ending after 151,971,095 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000681879 (exon 2) and 430 bp of flanking intronic sequence including the start site and splice acceptor and donor and is predicted to result in a null allele. |