| Primary Identifier | MGI:7539426 | Allele Type | Endonuclease-mediated |
| Gene | Daxx | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tyrosine codon 130 (TAT) in exon 3 was changed to alanine (GCT) (p.Y130A) using an sgRNA (targeting ATGTACACATAGATCTTAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the 4HB domain of the encoded peptide, affects Atrx binding. |