|  Help  |  About  |  Contact Us

Allele : Atp6ap2<em1Tiy> ATPase, H+ transporting, lysosomal accessory protein 2; endonuclease-mediated mutation 1, Tianxin Yang

Primary Identifier  MGI:7490239 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Atp6ap2
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 279 (AGG) and leucine codon 282 (CTT) in exon 8 were changed to valine (GTG, GTT) (p.R279V, p.L282V) using an sgRNA (targeting GAAGTCAAGGACCATCCTTGAGG) and ssODN template with CRISPR/Cas9 technology. These mutations block processing of the encoded peptide by FURIN (paired basic amino acid cleaving enzyme) and site 1 membrane-bound transcription factor peptidase (MBTPS1).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • PRR<R279V/L282V>,
  • PRR<R279V/L282V>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories